Example usage for java.lang Double NEGATIVE

Introduction

In this page you can find the example usage for java.lang Double NEGATIVE_INFINITY.

Prototype

double NEGATIVE_INFINITY

To view the source code for java.lang Double NEGATIVE_INFINITY.

Click Source Link

Document

A constant holding the negative infinity of type double .

Usage

From source file:Main.java

public static void main(String[] args) {

    System.out.println(Double.NEGATIVE_INFINITY);
}

From source file:Main.java

public static void main(String[] args) {
    System.out.printf("%.2e %n", Double.NaN);
    System.out.printf("%.2f %n", Double.POSITIVE_INFINITY);
    System.out.printf("%.2g %n", Double.NEGATIVE_INFINITY);
    System.out.printf("%(f %n", Double.POSITIVE_INFINITY);
    System.out.printf("%(f %n", Double.NEGATIVE_INFINITY);
}

From source file:FpError.java

public static void main(String[] args) {
    double res;/*from ww w  .java2  s  .  c  o m*/
    double divisor = 0;
    double dividend, root;

    // Get user input for numerator
    System.out.println("Forcing division by zero error");
    dividend = 10d;
    res = dividend / divisor;
    // Test for negative invifinity
    if (res == Double.NEGATIVE_INFINITY)
        System.out.println("result is NEGATIVE_INFINITY");
    if (res == Double.POSITIVE_INFINITY)
        System.out.println("result is POSITIVE_INFINITY");
    // Test for either infinity
    if (Double.isInfinite(res))
        System.out.println("result is infinite");

    // Get user input for square root
    System.out.println("\nCalculating square root (try negative)");
    root = 10d;
    res = Math.sqrt(root);
    if (Double.isNaN(res))
        System.out.println("result is Nan");
    else
        System.out.println("Square root = " + res);
}

From source file:edu.msu.cme.rdp.graph.utils.ContigMerger.java

public static void main(String[] args) throws IOException {
    final BufferedReader hmmgsResultReader;
    final IndexedSeqReader nuclContigReader;
    final double minBits;
    final int minProtLength;
    final Options options = new Options();
    final PrintStream out;
    final ProfileHMM hmm;
    final FastaWriter protSeqOut;
    final FastaWriter nuclSeqOut;
    final boolean prot;
    final boolean all;
    final String shortSampleName;

    options.addOption("a", "all", false,
            "Generate all combinations for multiple paths, instead of just the best");
    options.addOption("b", "min-bits", true, "Minimum bits score");
    options.addOption("l", "min-length", true, "Minimum length");
    options.addOption("s", "short_samplename", true,
            "short sample name, to be used as part of contig identifiers. This allow analyzing contigs together from different samples in downstream analysis ");
    options.addOption("o", "out", true, "Write output to file instead of stdout");

    try {/*from   w ww .ja va  2 s  .  c  o  m*/
        CommandLine line = new PosixParser().parse(options, args);

        if (line.hasOption("min-bits")) {
            minBits = Double.valueOf(line.getOptionValue("min-bits"));
        } else {
            minBits = Double.NEGATIVE_INFINITY;
        }

        if (line.hasOption("min-length")) {
            minProtLength = Integer.valueOf(line.getOptionValue("min-length"));
        } else {
            minProtLength = 0;
        }

        if (line.hasOption("short_samplename")) {
            shortSampleName = line.getOptionValue("short_samplename") + "_";
        } else {
            shortSampleName = "";
        }

        if (line.hasOption("out")) {
            out = new PrintStream(line.getOptionValue("out"));
        } else {
            out = System.err;
        }

        all = line.hasOption("all");

        args = line.getArgs();

        if (args.length != 3) {
            throw new Exception("Unexpected number of arguments");
        }

        hmmgsResultReader = new BufferedReader(new FileReader(new File(args[1])));
        nuclContigReader = new IndexedSeqReader(new File(args[2]));
        hmm = HMMER3bParser.readModel(new File(args[0]));

        prot = (hmm.getAlphabet() == SequenceType.Protein);

        if (prot) {
            protSeqOut = new FastaWriter(new File("prot_merged.fasta"));
        } else {
            protSeqOut = null;
        }
        nuclSeqOut = new FastaWriter(new File("nucl_merged.fasta"));

    } catch (Exception e) {
        new HelpFormatter().printHelp("USAGE: ContigMerger [options] <hmm> <hmmgs_file> <nucl_contig>",
                options);
        System.err.println("Error: " + e.getMessage());
        System.exit(1);
        throw new RuntimeException("I hate you javac");
    }

    String line;
    SearchDirection lastDir = SearchDirection.left; //So this has an assumption built in
    //It depends on hmmgs always outputting left fragments, then right
    //We can't just use the kmer to figure out if we've switched to another starting point
    //because we allow multiple starting model pos, so two different starting
    //positions can have the same starting kmer

    Map<String, Sequence> leftContigs = new HashMap();
    Map<String, Sequence> rightContigs = new HashMap();

    int contigsMerged = 0;
    int writtenMerges = 0;
    long startTime = System.currentTimeMillis();
    String kmer = null;
    String geneName = null;

    while ((line = hmmgsResultReader.readLine()) != null) {
        if (line.startsWith("#")) {
            continue;
        }

        String[] lexemes = line.trim().split("\t");
        if (lexemes.length != 12 || lexemes[0].equals("-")) {
            System.err.println("Skipping line: " + line);
            continue;
        }
        //contig_53493   nirk   1500:6:35:16409:3561/1   ADV15048   tcggcgctctacacgttcctgcagcccggg   40   210   70   left   -44.692   184   0
        int index = 0;

        String seqid = lexemes[0];
        geneName = lexemes[1];
        String readid = lexemes[2];
        String refid = lexemes[3];
        kmer = lexemes[4];
        int modelStart = Integer.valueOf(lexemes[5]);

        int nuclLength = Integer.valueOf(lexemes[6]);
        int protLength = Integer.valueOf(lexemes[7]);

        SearchDirection dir = SearchDirection.valueOf(lexemes[8]);
        if (dir != lastDir) {
            if (dir == SearchDirection.left) {
                List<MergedContig> mergedContigs = all
                        ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm)
                        : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm);

                contigsMerged++;

                for (MergedContig mc : mergedContigs) {
                    String mergedId = shortSampleName + geneName + "_" + mc.leftContig + "_" + mc.rightContig;
                    out.println(mergedId + "\t" + mc.length + "\t" + mc.score);

                    if (mc.score > minBits && mc.length > minProtLength) {
                        if (prot) {
                            protSeqOut.writeSeq(mergedId, mc.protSeq);
                        }
                        nuclSeqOut.writeSeq(mergedId, mc.nuclSeq);

                        writtenMerges++;
                    }
                }
                leftContigs.clear();
                rightContigs.clear();
            }

            lastDir = dir;
        }

        Sequence seq = nuclContigReader.readSeq(seqid);

        if (dir == SearchDirection.left) {
            leftContigs.put(seqid, seq);
        } else if (dir == SearchDirection.right) {
            rightContigs.put(seqid, seq);
        } else {
            throw new IOException("Cannot handle search direction " + dir);
        }
    }

    if (!leftContigs.isEmpty() || !rightContigs.isEmpty()) {
        List<MergedContig> mergedContigs = all ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm)
                : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm);

        for (MergedContig mc : mergedContigs) {
            String mergedId = shortSampleName + mc.gene + "_" + mc.leftContig + "_" + mc.rightContig;
            out.println(mergedId + "\t" + mc.length + "\t" + mc.score);
            contigsMerged++;

            if (mc.score > minBits && mc.length > minProtLength) {
                if (prot) {
                    protSeqOut.writeSeq(mergedId, mc.protSeq);
                }
                nuclSeqOut.writeSeq(mergedId, mc.nuclSeq);
                writtenMerges++;
            }
        }
    }

    out.close();
    if (prot) {
        protSeqOut.close();
    }
    nuclSeqOut.close();

    System.err.println("Read in " + contigsMerged + " contigs, wrote out " + writtenMerges
            + " merged contigs in " + ((double) (System.currentTimeMillis() - startTime) / 1000) + "s");
}

From source file:Main.java

/**
 * Returns next smaller float value considering precision of the argument.
 * /*from   w ww . j  a  va 2 s. c  om*/
 */
public static double nextDown(double d) {
    if (Double.isNaN(d) || d == Double.NEGATIVE_INFINITY) {
        return d;
    } else {
        if (d == 0.0f) {
            return -Float.MIN_VALUE;
        } else {
            return Double.longBitsToDouble(Double.doubleToRawLongBits(d) + ((d > 0.0f) ? -1 : +1));
        }
    }
}

From source file:Main.java

public static double max(double[] x, int length) {
    double m = Double.NEGATIVE_INFINITY;
    for (int i = 0; i < length; i++)
        if (x[i] > m)
            m = x[i];// ww  w .j  a v  a  2 s . co  m
    return m;
}

From source file:Util.java

public static int argmax(double[] elems) {
    int bestIdx = -1;
    double max = Double.NEGATIVE_INFINITY;
    for (int i = 0; i < elems.length; i++) {
        double elem = elems[i];
        if (elem > max) {
            max = elem;//from   www .  jav a  2s  . c o m
            bestIdx = i;
        }
    }
    return bestIdx;
}

From source file:mase.mason.world.GeomUtils.java

public static Pair<Double2D, Double2D> computeBB(Double2D[] points) {
    double xMin = Double.POSITIVE_INFINITY;
    double yMin = Double.POSITIVE_INFINITY;
    double xMax = Double.NEGATIVE_INFINITY;
    double yMax = Double.NEGATIVE_INFINITY;
    for (Double2D p : points) {
        xMin = Math.min(xMin, p.x);
        yMin = Math.min(yMin, p.y);
        xMax = Math.max(xMax, p.x);
        yMax = Math.max(yMax, p.y);
    }// w  ww  .  j  a  v  a  2s .  c  o  m
    return Pair.of(new Double2D(xMin, yMin), new Double2D(xMax, yMax));
}

From source file:Main.java

/**
 * Determines the minimum and maximum values in the <tt>array</tt>, ignoring any instances of <tt>noDataValue</tt>.
 * /*from   www.j  a v  a2  s  . co  m*/
 * @param array
 * @param noDataValue
 * @return a <tt>double[]</tt> where [0]==minimum and [1]==maximum
 */
public static double[] minMax(double[] array, double noDataValue) {
    double[] ret = null;
    double min = Double.POSITIVE_INFINITY, max = Double.NEGATIVE_INFINITY;
    double val;
    for (int i = 0; i < array.length; i++) {
        val = array[i];
        if (val != noDataValue) {
            min = (val < min) ? val : min;
            max = (val > max) ? val : max;
        }
    }
    if (!Double.isInfinite(min) & !Double.isInfinite(max)) {
        ret = new double[] { min, max };
    }

    return ret;
}

From source file:com.ibm.bluej.commonutil.DenseVectors.java

public static int maxIndex(double[] v) {
    int maxNdx = 0;
    double max = Double.NEGATIVE_INFINITY;
    for (int i = 0; i < v.length; ++i) {
        if (v[i] > max) {
            max = v[i];/*from  w w w  .  jav  a  2 s.co  m*/
            maxNdx = i;
        }
    }
    return maxNdx;
}

Example usage for java.lang Double NEGATIVE_INFINITY

Introduction

Prototype

Document

Usage