List of usage examples for javafx.stage Stage Stage
public Stage()
From source file:tachyon.view.ProjectProperties.java
public ProjectProperties(JavaProject project, Window w) { this.project = project; stage = new Stage(); stage.initOwner(w);//from w ww . j a va2 s . c om stage.initModality(Modality.APPLICATION_MODAL); stage.setWidth(600); stage.setTitle("Project Properties - " + project.getProjectName()); stage.getIcons().add(tachyon.Tachyon.icon); stage.setResizable(false); HBox mai, libs, one, two, thr, fou; ListView<String> compileList, runtimeList; Button compileAdd, compileRemove, preview, selectIm, runtimeAdd, runtimeRemove; TextField iconField; stage.setScene(new Scene(new VBox(5, pane = new TabPane( new Tab("Library Settings", box1 = new VBox(15, libs = new HBox(10, new Label("External Libraries"), libsView = new ListView<>(), new VBox(5, addJar = new Button("Add Jar"), removeJar = new Button("Remove Jar"))))), new Tab("Program Settings", new ScrollPane(box2 = new VBox(15, one = new HBox(10, new Label("Main-Class"), mainClass = new TextField(project.getMainClassName()), select = new Button("Select")), two = new HBox(10, new Label("Compile-Time Arguments"), compileList = new ListView<>(), new VBox(5, compileAdd = new Button("Add Argument"), compileRemove = new Button("Remove Argument")))))), new Tab("Deployment Settings", box3 = new VBox(15, thr = new HBox(10, new Label("Icon File"), iconField = new TextField(project.getFileIconPath()), preview = new Button("Preview Image"), selectIm = new Button("Select Icon")), fou = new HBox(10, new Label("Runtime Arguments"), runtimeList = new ListView<>(), new VBox(5, runtimeAdd = new Button("Add Argument"), runtimeRemove = new Button("Remove Argument")))))), new VBox(15, mai = new HBox(10, cancel = new Button("Cancel"), confirm = new Button("Confirm")))))); if (applyCss.get()) { stage.getScene().getStylesheets().add(css); } for (Tab b : pane.getTabs()) { b.setClosable(false); } mainClass.setPromptText("Main-Class"); box1.setPadding(new Insets(5, 10, 5, 10)); mai.setAlignment(Pos.CENTER_RIGHT); mai.setPadding(box1.getPadding()); libs.setAlignment(Pos.CENTER); one.setAlignment(Pos.CENTER); two.setAlignment(Pos.CENTER); thr.setAlignment(Pos.CENTER); fou.setAlignment(Pos.CENTER); box1.setAlignment(Pos.CENTER); box2.setPadding(box1.getPadding()); box2.setAlignment(Pos.CENTER); box3.setPadding(box1.getPadding()); box3.setAlignment(Pos.CENTER); mainClass.setEditable(false); mainClass.setPrefWidth(200); for (JavaLibrary lib : project.getAllLibs()) { libsView.getItems().add(lib.getBinaryAbsolutePath()); } for (String sa : project.getCompileTimeArguments().keySet()) { compileList.getItems().add(sa + ":" + project.getCompileTimeArguments().get(sa)); } for (String sa : project.getRuntimeArguments()) { runtimeList.getItems().add(sa); } compileAdd.setOnAction((e) -> { Dialog<Pair<String, String>> dialog = new Dialog<>(); dialog.setTitle("Compiler Argument"); dialog.initOwner(stage); dialog.setHeaderText("Entry the argument"); ButtonType loginButtonType = new ButtonType("Done", ButtonData.OK_DONE); dialog.getDialogPane().getButtonTypes().addAll(loginButtonType, ButtonType.CANCEL); GridPane grid = new GridPane(); grid.setHgap(10); grid.setVgap(10); grid.setPadding(new Insets(20, 150, 10, 10)); TextField username = new TextField(); username.setPromptText("Key"); TextField password = new TextField(); password.setPromptText("Value"); grid.add(new Label("Key:"), 0, 0); grid.add(username, 1, 0); grid.add(new Label("Value:"), 0, 1); grid.add(password, 1, 1); Node loginButton = dialog.getDialogPane().lookupButton(loginButtonType); loginButton.setDisable(true); username.textProperty().addListener((observable, oldValue, newValue) -> { loginButton.setDisable(newValue.trim().isEmpty()); }); dialog.getDialogPane().setContent(grid); Platform.runLater(() -> username.requestFocus()); dialog.setResultConverter(dialogButton -> { if (dialogButton == loginButtonType) { return new Pair<>(username.getText(), password.getText()); } return null; }); Optional<Pair<String, String>> result = dialog.showAndWait(); if (result.isPresent()) { compileList.getItems().add(result.get().getKey() + ":" + result.get().getValue()); } }); compileRemove.setOnAction((e) -> { if (compileList.getSelectionModel().getSelectedItem() != null) { compileList.getItems().remove(compileList.getSelectionModel().getSelectedItem()); } }); runtimeAdd.setOnAction((e) -> { TextInputDialog dia = new TextInputDialog(); dia.setTitle("Add Runtime Argument"); dia.setHeaderText("Enter an argument"); dia.initOwner(stage); Optional<String> res = dia.showAndWait(); if (res.isPresent()) { runtimeList.getItems().add(res.get()); } }); runtimeRemove.setOnAction((e) -> { if (runtimeList.getSelectionModel().getSelectedItem() != null) { runtimeList.getItems().remove(runtimeList.getSelectionModel().getSelectedItem()); } }); preview.setOnAction((e) -> { if (!iconField.getText().isEmpty()) { if (iconField.getText().endsWith(".ico")) { List<BufferedImage> read = new ArrayList<>(); try { read.addAll(ICODecoder.read(new File(iconField.getText()))); } catch (IOException ex) { } if (read.size() >= 1) { Image im = SwingFXUtils.toFXImage(read.get(0), null); Stage st = new Stage(); st.initOwner(stage); st.initModality(Modality.APPLICATION_MODAL); st.setTitle("Icon Preview"); st.getIcons().add(Tachyon.icon); st.setScene(new Scene(new BorderPane(new ImageView(im)))); if (applyCss.get()) { st.getScene().getStylesheets().add(css); } st.showAndWait(); } } else if (iconField.getText().endsWith(".icns")) { try { BufferedImage ima = Imaging.getBufferedImage(new File(iconField.getText())); if (ima != null) { Image im = SwingFXUtils.toFXImage(ima, null); Stage st = new Stage(); st.initOwner(stage); st.initModality(Modality.APPLICATION_MODAL); st.setTitle("Icon Preview"); st.getIcons().add(Tachyon.icon); st.setScene(new Scene(new BorderPane(new ImageView(im)))); if (applyCss.get()) { st.getScene().getStylesheets().add(css); } st.showAndWait(); } } catch (ImageReadException | IOException ex) { } } else { Image im = new Image(new File(iconField.getText()).toURI().toString()); Stage st = new Stage(); st.initOwner(stage); st.initModality(Modality.APPLICATION_MODAL); st.setTitle("Icon Preview"); st.getIcons().add(Tachyon.icon); st.setScene(new Scene(new BorderPane(new ImageView(im)))); if (applyCss.get()) { st.getScene().getStylesheets().add(css); } st.showAndWait(); } } }); selectIm.setOnAction((e) -> { FileChooser fc = new FileChooser(); fc.setTitle("Icon File"); String OS = System.getProperty("os.name").toLowerCase(); fc.getExtensionFilters().add(new ExtensionFilter("Icon File", OS.contains("win") ? getWindowsImageExtensions() : getMacImageExtensions())); fc.setSelectedExtensionFilter(fc.getExtensionFilters().get(0)); File lf = fc.showOpenDialog(stage); if (lf != null) { iconField.setText(lf.getAbsolutePath()); } }); addJar.setOnAction((e) -> { FileChooser f = new FileChooser(); f.setTitle("External Libraries"); f.setSelectedExtensionFilter(new ExtensionFilter("Jar Files", "*.jar")); List<File> showOpenMultipleDialog = f.showOpenMultipleDialog(stage); if (showOpenMultipleDialog != null) { for (File fi : showOpenMultipleDialog) { if (!libsView.getItems().contains(fi.getAbsolutePath())) { libsView.getItems().add(fi.getAbsolutePath()); } } } }); removeJar.setOnAction((e) -> { String selected = libsView.getSelectionModel().getSelectedItem(); if (selected != null) { libsView.getItems().remove(selected); } }); select.setOnAction((e) -> { List<String> all = getAll(); ChoiceDialog<String> di = new ChoiceDialog<>(project.getMainClassName(), all); di.setTitle("Select Main Class"); di.initOwner(stage); di.setHeaderText("Select A Main Class"); Optional<String> show = di.showAndWait(); if (show.isPresent()) { mainClass.setText(show.get()); } }); cancel.setOnAction((e) -> { stage.close(); }); confirm.setOnAction((e) -> { project.setMainClassName(mainClass.getText()); project.setFileIconPath(iconField.getText()); project.setRuntimeArguments(runtimeList.getItems()); HashMap<String, String> al = new HashMap<>(); for (String s : compileList.getItems()) { String[] spl = s.split(":"); al.put(spl[0], spl[1]); } project.setCompileTimeArguments(al); project.setAllLibs(libsView.getItems()); stage.close(); }); }
From source file:org.mskcc.shenkers.control.track.fasta.FastaViewNGTest.java
@Test public void testGetGraphic() throws InterruptedException { String title = ""; CountDownLatch l = new CountDownLatch(1); Platform.runLater(() -> {//from w ww . ja v a 2 s . c om String st = "CGATCGCCATTGAGCAAGTAAGCCAACTTTCGGCTCGCGTGTACGCGATAAGTAGGTGCCCTCTGCATCCGACGCACTTCAGCCGAACCACTTGCGGGAATTTGGGGGAGTGCTGATACGACGGCATAGGAATGGAGCTCTTTAAGTGCGTCTACACACGGACCGTACTTGGCCAAATCGGCAGTCAGTTGTATT"; FastaView tp = new FastaView(); tp.flip.setValue(true); tp.setSequence(0, st); Scene scene = new Scene(tp, 300, 300, Color.GRAY); Stage stage = new Stage(); stage.setScene(scene); stage.setOnHidden(e -> { l.countDown(); }); stage.show(); }); l.await(); }
From source file:jlotoprint.MainViewController.java
public static Stage loadTemplateChooser() { final Stage stage = new Stage(); try {//from w ww. j a v a2 s .c o m FXMLLoader dialog = new FXMLLoader(MainViewController.class.getResource("TemplateDialog.fxml")); Parent root = (Parent) dialog.load(); root.addEventHandler(TemplateDialogEvent.CANCELED, (actionEvent) -> { stage.close(); }); stage.setScene(new Scene(root)); stage.setTitle("Choose a template"); stage.getIcons().add(new Image("file:resources/icon.png")); stage.initModality(Modality.WINDOW_MODAL); stage.initOwner(JLotoPrint.stage.getScene().getWindow()); stage.show(); } catch (IOException ex) { Logger.getLogger(MainViewController.class.getName()).log(Level.SEVERE, null, ex); return null; } return stage; }
From source file:account.management.controller.ViewSalaryVoucherController.java
/** * Initializes the controller class./* w w w . j a va 2s . c o m*/ */ @Override public void initialize(URL url, ResourceBundle rb) { this.voucher_no.setCellValueFactory(new PropertyValueFactory("id")); this.date.setCellValueFactory(new PropertyValueFactory("date")); this.section.setCellValueFactory(new PropertyValueFactory("section")); this.name.setCellValueFactory(new PropertyValueFactory("name")); this.basis.setCellValueFactory(new PropertyValueFactory("basis")); this.amount.setCellValueFactory(new PropertyValueFactory("total")); final ContextMenu contextMenu = new ContextMenu(); MenuItem item1 = new MenuItem(" View "); item1.setOnAction(new EventHandler<ActionEvent>() { public void handle(ActionEvent e) { Data.salaryVoucher = table.getSelectionModel().getSelectedItem(); try { Parent root = FXMLLoader .load(getClass().getResource(MetaData.viewPath + "EditSalaryVoucher.fxml")); Scene scene = new Scene(root); Stage stage = new Stage(); scene.setRoot(root); stage.setResizable(false); stage.setTitle("Salary Voucher"); stage.setScene(scene); stage.showAndWait(); int index = table.getSelectionModel().getSelectedIndex(); getData(); } catch (IOException ex) { Logger.getLogger(ViewSalaryVoucherController.class.getName()).log(Level.SEVERE, null, ex); } } }); contextMenu.getItems().addAll(item1); this.table.setContextMenu(contextMenu); }
From source file:org.mskcc.shenkers.view.IntervalViewNGTest.java
public void testRangeSetIntervalView() throws InterruptedException { System.out.println("testIntervalView"); CountDownLatch l = new CountDownLatch(1); System.out.println("before"); Platform.runLater(() -> {//from www. j av a2 s .co m System.out.println("running"); double[][] intervals = { { .1, .2 } }; // Range r = null; RangeSet<Double> rs = TreeRangeSet.create(); rs.add(Range.closed(.1, .2)); rs.add(Range.closed(.2, .3)); rs.add(Range.closed(.32, .35)); rs.add(Range.closed(.6, .8)); RangeSetIntervalView p = new RangeSetIntervalView(0, 100); p.setData(Arrays.asList(new Pair(10, 20), new Pair(20, 30), new Pair(32, 35), new Pair(60, 80))); // p.prefTileHeightProperty().bind(p.heightProperty()); Stage stage = new Stage(); stage.setOnHidden(e -> { l.countDown(); System.out.println("count " + l.getCount()); }); Scene scene = new Scene(p, 300, 300, Color.GRAY); stage.setTitle("SimpleIntervalView"); stage.setScene(scene); stage.show(); }); System.out.println("after"); l.await(); Thread.sleep(1000); }
From source file:at.ac.tuwien.qse.sepm.gui.FullscreenWindow.java
@FXML private void initialize() { this.stage = new Stage(); this.scene = new Scene(this); stage.setScene(scene);//from ww w . j av a2 s .c o m image.setPreserveRatio(true); getChildren().add(0, image); hideButton.setOnAction((e) -> menu.setOpacity(0.0)); menu.setOnMouseEntered(e -> menu.setOpacity(1.0)); root.setOnKeyPressed(new EventHandler<KeyEvent>() { public void handle(final KeyEvent keyEvent) { if (keyEvent.getCode() == KeyCode.RIGHT) { bt_nextPressed(null); } if (keyEvent.getCode() == KeyCode.LEFT) { bt_previousPressed(null); } if (keyEvent.getCode() == KeyCode.ESCAPE) { stage.close(); } if (keyEvent.getCode() == KeyCode.DIGIT1) { ratingPicker.setRating(Rating.BAD); } if (keyEvent.getCode() == KeyCode.DIGIT2) { ratingPicker.setRating(Rating.NEUTRAL); } if (keyEvent.getCode() == KeyCode.DIGIT3) { ratingPicker.setRating(Rating.GOOD); } } }); ratingPicker.setRatingChangeHandler(this::handleRatingChange); }
From source file:com.toyota.carservice.config.config2.java
public Object newStage3(Stage stage, Label lb, String load, String judul, boolean resize, StageStyle style, boolean maximized) { try {/*w ww .ja v a 2s .c om*/ Stage st = new Stage(); stage = (Stage) lb.getScene().getWindow(); FXMLLoader root = new FXMLLoader(getClass().getResource(load)); Scene scene = new Scene(root.load()); st.initStyle(style); st.setResizable(resize); st.setMaximized(maximized); st.setTitle(judul); st.setScene(scene); ApplicationContext appContex = config.getInstance().getApplicationContext(); Resource resource = appContex.getResource("classpath:com/toyota/carservice/img/kallatoyota.png"); st.getIcons().add(new Image(resource.getURI().toString())); st.show(); return root.getController(); } catch (Exception e) { e.printStackTrace(); } return null; }
From source file:ui.ChoseFonctionnalite.java
private void startClientMode(ActionEvent eventT) { //File config = new File("resource/config.json"); String host = ""; String port = "8000"; Stage stageModal = new Stage(); Pane root = new Pane(); root.setBackground(new Background(new BackgroundImage(new Image("resource/background.jpg"), BackgroundRepeat.NO_REPEAT, BackgroundRepeat.NO_REPEAT, BackgroundPosition.CENTER, new BackgroundSize(530, 400, true, true, true, true)))); stageModal.setScene(new Scene(root, 200, 200)); stageModal.initStyle(StageStyle.UTILITY); Label adresse = new Label("Adresse serveur:"); adresse.setLayoutX(10);/*from w ww . j a v a2 s . c o m*/ adresse.setLayoutY(10); adresse.setFont(Font.font("Arial", 16)); JFXTextField adresseInput = new JFXTextField("127.0.0.1"); adresseInput.setPrefWidth(180); adresseInput.setLayoutX(10); adresseInput.setLayoutY(40); JFXButton valider = new JFXButton("Se connecter"); valider.setCursor(Cursor.HAND); valider.setMinSize(100, 30); valider.setLayoutX(20); valider.setLayoutY(130); valider.setFont(new Font(20)); valider.setStyle("-fx-background-color: #9E21FF;"); valider.setOnAction(event -> { if (adresseInput.getText() != "") { stageModal.close(); InitClient initializeClient = new InitClient(stage, adresseInput.getText(), port); } }); root.getChildren().add(valider); root.getChildren().add(adresse); root.getChildren().add(adresseInput); stageModal.setTitle("Adresse serveur"); stageModal.initModality(Modality.WINDOW_MODAL); stageModal.initOwner(((Node) eventT.getSource()).getScene().getWindow()); stageModal.show(); }
From source file:UI.MainPageController.java
/** * This will select the file to say to and then call the pdf's build function * to export the updated pdf/*from w w w . ja v a 2s. co m*/ */ @FXML private void exportPDFPress() { FileChooser chooser = new FileChooser(); File file = chooser.showSaveDialog(new Stage()); if (file == null) { showWarning("No file selected or created"); filename = ""; } else { try { if (!file.exists()) { file.createNewFile(); } } catch (Exception e) { ; } filename = file.getPath(); try { pdf.buildPDF(filename); } catch (Exception e) { System.out.println("Export PDF FAIL"); } } }
From source file:com.ggvaidya.scinames.summary.HigherStabilityView.java
public HigherStabilityView(ProjectView pv) { projectView = pv;//from w w w . j a va 2 s . com stage = new Stage(); controller = TabularDataViewController.createTabularDataView(); scene = controller.getScene(); init(); // Go go stagey scene. stage.setScene(scene); }