Example usage for org.apache.hadoop.mapreduce.lib.input FileInputFormat subclass-usage

List of usage examples for org.apache.hadoop.mapreduce.lib.input FileInputFormat subclass-usage

  1. HOME
  2. Java
  3. org.apache.hadoop.mapreduce.lib.input.*
  4. FileInputFormat
  5. Example usage for org.apache.hadoop.mapreduce.lib.input FileInputFormat subclass-usage

Introduction

In this page you can find the example usage for org.apache.hadoop.mapreduce.lib.input FileInputFormat subclass-usage.

Usage

From source file fi.tkk.ics.hadoop.bam.VCFInputFormat.java

/** An {@link org.apache.hadoop.mapreduce.InputFormat} for VCF files. Values
 * are the individual records; see {@link VCFRecordReader} for the meaning of
 * the key.
 */
public class VCFInputFormat extends FileInputFormat<LongWritable, VariantContextWritable> {
    /** Whether file extensions are to be trusted, defaults to true.

From source file fire.util.fileformats.pdf.PdfInputFormat.java

public class PdfInputFormat extends FileInputFormat<Text, Text> {

    @Override
    public RecordReader<Text, Text> createRecordReader(InputSplit split, TaskAttemptContext context)
            throws IOException, InterruptedException {

From source file format.IndexableFileInputFormat.java

/**
 * Abstract class representing a <code>FileInputFormat</code> for
 * <code>Indexable</code> objects.
 */
public abstract class IndexableFileInputFormat<K, V extends Indexable> extends FileInputFormat<K, V> {

From source file format.OverlapInputFormat.java

/**
 * An {@link org.apache.hadoop.mapreduce.InputFormat} for 4mc compressed files.
 * This is the base class, mainly managing input splits, leveraging 4mc block index.
 *
 * Subclasses must only make sure to provide an implementation of createRecordReader.
 * See {@link com.hadoop.mapreduce.FourMcTextInputFormat} as example reading text files.

From source file format.OverlapLengthInputFormat.java

/**
 * FixedLengthInputFormat is an input format used to read input files
 * which contain fixed length records.  The content of a record need not be
 * text.  It can be arbitrary binary data.  Users must configure the record
 * length property by calling:
 * OverlapLengthInputFormat.setRecordLength(conf, recordLength);<br><br> or

From source file fr.ens.biologie.genomique.eoulsan.bio.io.hadoop.FastqInputFormat.java

/**
 * This class define an InputFormat for FASTQ files for the Hadoop MapReduce
 * framework.
 * @since 1.0
 * @author Laurent Jourdren
 */

From source file framework.util.IndexableFileInputFormat.java

/**
 * Abstract class representing a <code>FileInputFormat</code> for
 * <code>Indexable</code> objects.
 */
public abstract class IndexableFileInputFormat<K, V extends Indexable> extends FileInputFormat<K, V> {

From source file genepi.hadoop.formats.NLineInputFormat.java

/**
 * NLineInputFormat which splits N lines of input as one split.
 * 
 * In many "pleasantly" parallel applications, each process/mapper processes the
 * same input file (s), but with computations are controlled by different
 * parameters.(Referred to as "parameter sweeps"). One way to achieve this, is

From source file gov.jgi.meta.hadoop.input.FastaBlockInputFormat.java

/** An {@link FastaBlockInputFormat} is for fasta text files.  Files are broken
 * records seperated by ">" eg:
 * >756:1:1:1074:20235/1
 * TGCAGCTCAACANCGTCGGCTACGACNNCACCNNNGAGCGCATCGGCTNCNNNANNNCCTNNNNNNNNCGGGAGGT
 * >756:1:1:1074:20235/2
 * TCGTCGCTGAAGCCTTCTTCCACCTTGGCGTTGAACGCCTCCATGTCCAGTGGAGTCCCCTGGACCCCGCGCCCGC

From source file gov.jgi.meta.hadoop.input.FastaInputFormat.java

/** An {@link FastaInputFormat} is for fasta text files.  Files are broken
 * records seperated by ">" eg:
 * >756:1:1:1074:20235/1
 * TGCAGCTCAACANCGTCGGCTACGACNNCACCNNNGAGCGCATCGGCTNCNNNANNNCCTNNNNNNNNCGGGAGGT
 * >756:1:1:1074:20235/2
 * TCGTCGCTGAAGCCTTCTTCCACCTTGGCGTTGAACGCCTCCATGTCCAGTGGAGTCCCCTGGACCCCGCGCCCGC