Java tutorial
/* ensembl-rest-client Java client for the Ensembl REST API. Copyright (c) 2013-2014 held jointly by the individual authors. This library is free software; you can redistribute it and/or modify it under the terms of the GNU Lesser General Public License as published by the Free Software Foundation; either version 3 of the License, or (at your option) any later version. This library is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; with out even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License for more details. You should have received a copy of the GNU Lesser General Public License along with this library; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA. > http://www.fsf.org/licensing/licenses/lgpl.html > http://www.opensource.org/licenses/lgpl-license.php */ package com.github.heuermh.ensemblrestclient; import static com.github.heuermh.ensemblrestclient.JacksonSequenceConverter.parseSequence; import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertNotNull; import static org.mockito.Mockito.mock; import static org.mockito.Mockito.when; import java.io.InputStream; import java.io.IOException; import org.junit.Before; import org.junit.Test; import com.fasterxml.jackson.core.JsonFactory; import retrofit.converter.ConversionException; import retrofit.mime.TypedInput; /** * Unit test for JacksonSequenceConverter. * * @author Michael Heuer */ public final class JacksonSequenceConverterTest { private JsonFactory jsonFactory; private JacksonSequenceConverter converter; @Before public void setUp() { jsonFactory = new JsonFactory(); converter = new JacksonSequenceConverter(jsonFactory); } @Test(expected = NullPointerException.class) public void testConstructorNullJsonFactory() { new JacksonSequenceConverter(null); } @Test public void testConstructor() { assertNotNull(converter); } @Test public void testParseSequence_X_1000000_1000100_1() throws Exception { Sequence sequence = parseSequence(jsonFactory, getClass().getResourceAsStream("X_1000000_1000100_1.json")); assertNotNull(sequence); assertEquals("chromosome:GRCh37:X:1000000:1000100:1", sequence.getIdentifier()); assertEquals( "GAAACAGCTACTTGGAAGGCTGAAGCAGGAGGATTGTTTGAGTCTAGGAGTTTGAGGCTGCAGTGAGTTATGAGCACACCACGGCACTCCAGCCTGGGAGA", sequence.getSequence()); assertEquals("dna", sequence.getMolecule()); } @Test public void testFromBody() throws Exception { InputStream inputStream = getClass().getResourceAsStream("X_1000000_1000100_1.json"); TypedInput body = mock(TypedInput.class); when(body.in()).thenReturn(inputStream); Sequence sequence = (Sequence) converter.fromBody(body, Sequence.class); assertNotNull(sequence); } @Test(expected = ConversionException.class) public void testFromBodyIOException() throws Exception { TypedInput body = mock(TypedInput.class); when(body.in()).thenThrow(new IOException()); converter.fromBody(body, Sequence.class); } @Test(expected = UnsupportedOperationException.class) public void testToBody() { converter.toBody(new Object()); } }